¡@
python Programming Glossary: mismatchHow to set the default encoding to UTF-8 in Python? [duplicate] http://stackoverflow.com/questions/11741574/how-to-set-the-default-encoding-to-utf-8-in-python 'ascii' sys.getfilesystemencoding 'UTF 8' BTW This mismatch is especially troubling eg. it raises a UnicodeError in virtualenv..
http://stackoverflow.com/questions/1275646/python-3-and-static-typing and output is enforced an AssertionError is raised on mismatch. This module also has a test function func which should fail..
ubuntu ImportError: cannot import name MAXREPEAT http://stackoverflow.com/questions/16297892/ubuntu-importerror-cannot-import-name-maxrepeat
http://stackoverflow.com/questions/1711408/help-installing-cx-oracle 5.0.1 StringVar.c 392 warning C4018 ' ' signed unsigned mismatch c pydev cx_oracle 5.0.1 StringVar.c 417 warning C4018 ' ' signed.. 5.0.1 StringVar.c 417 warning C4018 ' ' signed unsigned mismatch c pydev cx_oracle 5.0.1 ObjectVar.c 117 warning C4018 ' ' signed.. 5.0.1 ObjectVar.c 117 warning C4018 ' ' signed unsigned mismatch c pydev cx_oracle 5.0.1 ObjectVar.c 134 warning C4018 ' ' signed..
http://stackoverflow.com/questions/17142336/compare-file-namesnot-content-recursively-between-two-directories-with-case-se new newout.txt The result should be pre_INPUT.txt case mismatch new OUTput.txt Case mismatch new newout.txt file not exist in.. should be pre_INPUT.txt case mismatch new OUTput.txt Case mismatch new newout.txt file not exist in f1 python python 2.7 share..
django, python and link encryption http://stackoverflow.com/questions/2291176/django-python-and-link-encryption for AES so here we pad it # with spaces if necessary. mismatch len plain 16 if mismatch 0 padding 16 mismatch ' ' plain padding.. it # with spaces if necessary. mismatch len plain 16 if mismatch 0 padding 16 mismatch ' ' plain padding ciph encryption_obj.encrypt.. necessary. mismatch len plain 16 if mismatch 0 padding 16 mismatch ' ' plain padding ciph encryption_obj.encrypt plain # Finally..
Search for string allowing for one mismatch in any location of the string http://stackoverflow.com/questions/2420412/search-for-string-allowing-for-one-mismatch-in-any-location-of-the-string for string allowing for one mismatch in any location of the string I am working with DNA sequences.. But I also what to find a close match defined as wrong mismatched at any location but only one location and record the location.. AGCCTCCCATGATAGAACAGATCAT A close match with a mismatch at position 13. Speed is not a big issue because I am only doing..
Am I parsing this HTTP POST request properly? http://stackoverflow.com/questions/3275081/am-i-parsing-this-http-post-request-properly code can be seen in the revision history I hope I didn't mismatch any parentheses if line 0 .format boundary finished True if..
PyObjc vs RubyCocoa for Mac development: Which is more mature? http://stackoverflow.com/questions/426607/pyobjc-vs-rubycocoa-for-mac-development-which-is-more-mature languages such as Ruby and Python there is enough of a mismatch in the language models that you will have to at least understand..
Python import MySQLdb error - Mac 10.6 http://stackoverflow.com/questions/4730787/python-import-mysqldb-error-mac-10-6 the updated output from otool you can see that there is a mismatch of library path names. The MySQLdb extension is asking for a..
How to add items into a numpy array http://stackoverflow.com/questions/5064822/how-to-add-items-into-a-numpy-array stuff like a n array 1 3 4 x but numpy complained of shape mismatch. I tried iterating through a and appending element x to each..
Named dtype array: Difference between a[0]['name'] and a['name'][0]? http://stackoverflow.com/questions/9470604/named-dtype-array-difference-between-a0name-and-aname0 a 'tuple' 0 1 2 # ok a 0 'tuple' 1 2 # ValueError shape mismatch on array construction I would have expected that both of the..
|