¡@
python Programming Glossary: i.ePython strings split with multiple separators http://stackoverflow.com/questions/1059559/python-strings-split-with-multiple-separators text with punctuation and I want an array of the words. i.e Hey you what are you doing here should be 'hey' 'you' 'what'..
Class method differences in Python: bound, unbound and static http://stackoverflow.com/questions/114214/class-method-differences-in-python-bound-unbound-and-static a_test.method_one is translated to Test.method_one a_test i.e. a call to an unbound method. Because of that a call to your..
Differences between isinstance() and type() in python http://stackoverflow.com/questions/1549801/differences-between-isinstance-and-type-in-python to treat all kinds of strings and maybe other scalar types i.e. ones you can't loop on one way all containers lists sets dicts..
Threading in a PyQt application: Use Qt threads or Python threads? http://stackoverflow.com/questions/1595649/threading-in-a-pyqt-application-use-qt-threads-or-python-threads What are advantages and disadvantages of using PyQt4's i.e. Qt's threads over native Python threads from the threading..
Finding local IP addresses using Python's stdlib http://stackoverflow.com/questions/166506/finding-local-ip-addresses-using-pythons-stdlib using Python's stdlib How can I find local IP addresses i.e. 192.168.x.x or 10.0.x.x in Python platform independently and..
Understanding kwargs in Python http://stackoverflow.com/questions/1769403/understanding-kwargs-in-python argument. Can I also do this for specifying time deltas i.e. timedelta hours time1 How exactly does it work Is it classes..
How do I execute a program from python? os.system fails due to spaces in path http://stackoverflow.com/questions/204017/how-do-i-execute-a-program-from-python-os-system-fails-due-to-spaces-in-path than a string so arguments are more easily delimited. i.e. import subprocess subprocess.call 'C Temp a b c Notepad.exe'..
convert integer to a string in a given numeric base in python http://stackoverflow.com/questions/2267362/convert-integer-to-a-string-in-a-given-numeric-base-in-python perform the inverse creation of a string from an integer. i.e. I want some function int2base num base such that int int2base..
Print in terminal with colors using Python? http://stackoverflow.com/questions/287871/print-in-terminal-with-colors-using-python a good introduction. If you are not using extended ASCII i.e. not on a PC you are stuck with the ascii characters below 127..
http://stackoverflow.com/questions/316866/ping-a-site-in-python . Also remember that Python requires root to spawn ICMP i.e. ping sockets in linux. import ping socket try ping.verbose_ping..
*args and **kwargs? [duplicate] http://stackoverflow.com/questions/3394835/args-and-kwargs sure how many arguments might be passed to your function i.e. it allows you pass an arbitrary number of arguments to your..
http://stackoverflow.com/questions/3684484/peak-detection-in-a-2d-array local maximum filter. Returns a boolean mask of the peaks i.e. 1 when the pixel's value is the neighborhood maximum 0 otherwise..
What are some good Python ORM solutions? [closed] http://stackoverflow.com/questions/53428/what-are-some-good-python-orm-solutions I think Django might be a little more than I really need i.e. more features than I really need slower . Anyone have any experience..
Old style and new style classes in Python http://stackoverflow.com/questions/54867/old-style-and-new-style-classes-in-python classes are created by specifying another new style class i.e. a type as a parent class or the top level type object if no..
How can you profile a Python script? http://stackoverflow.com/questions/582336/how-can-you-profile-a-python-script Sometimes the given answers are somewhat kludgey i.e. adding timing code to __main__ so I thought I'd share my solution...
Django Passing Custom Form Parameters to Formset http://stackoverflow.com/questions/622982/django-passing-custom-form-parameters-to-formset approach and doesn't affect ServiceForm in any way i.e. by making it difficult to subclass . You'll get some strange.. it difficult to subclass . You'll get some strange naming i.e. the formset will be called '_curriedFormSet' instead of 'ServiceFormFormSet'..
What's the difference between list and tuples in Python? http://stackoverflow.com/questions/626759/whats-the-difference-between-list-and-tuples-in-python their usage. Tuples are heterogeneous data structures i.e. their entries have different meanings while lists are homogeneous..
Is there a portable way to get the current username in Python? http://stackoverflow.com/questions/842059/is-there-a-portable-way-to-get-the-current-username-in-python portable way to get the current user's username in Python i.e. one that works under both Linux and Windows at least . It would..
Making a flat list out of list of lists in Python [duplicate] http://stackoverflow.com/questions/952914/making-a-flat-list-out-of-list-of-lists-in-python copies is I times the sum of x for x from 1 to L excluded i.e. I L 2 2 . The list comprehension just generates one list once..
When does python choose to intern a string http://stackoverflow.com/questions/10622472/when-does-python-choose-to-intern-a-string should have to s1 is s2 give False Where is limit I.e. I am asking how long a string has to be before python starts..
Calling Python from Objective-C http://stackoverflow.com/questions/1308079/calling-python-from-objective-c superclass that creates concrete subclass instances I.e. @interface Abstract NSObject unsigned int foo NSString aBar..
Convert Variable Name to String? http://stackoverflow.com/questions/1534504/convert-variable-name-to-string the 'argument_data' string to an actual identifier. I.e. If argument_data identifier name is available in the random_function..
Search for string allowing for one mismatch in any location of the string http://stackoverflow.com/questions/2420412/search-for-string-allowing-for-one-mismatch-in-any-location-of-the-string performing the search with a wildcard in each position. I.e. search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT..
How do I filter ForeignKey choices in a Django ModelForm? http://stackoverflow.com/questions/291945/how-do-i-filter-foreignkey-choices-in-a-django-modelform models.ForeignKey Company base_rate models.ForeignKey Rate I.e. there are multiple Companies each having a range of Rates and..
How to set time limit on input http://stackoverflow.com/questions/2933399/how-to-set-time-limit-on-input to the main thread from the timer thread. I.e. import thread import threading def raw_input_with_timeout prompt..
Does NLTK have a tool for dependency parsing? http://stackoverflow.com/questions/3125926/does-nltk-have-a-tool-for-dependency-parsing I cannot figure out how to parse grammatical dependencies. I.e. this is an example from the Stanford Parser. I want to be able..
http://stackoverflow.com/questions/3490738/how-to-sum-dict-elements one final dict that will contain the sum of all dicts. I.e the result will be 'a' 5 'b' 7 N.B every dict in the list will..
Setting smaller buffer size for sys.stdin? http://stackoverflow.com/questions/3670323/setting-smaller-buffer-size-for-sys-stdin one and possibly different buffering using os.fdopen . I.e. import os import sys newin os.fdopen sys.stdin.fileno 'r' 100..
How do I get the UTC time of “midnight” for a given timezone? http://stackoverflow.com/questions/373370/how-do-i-get-the-utc-time-of-midnight-for-a-given-timezone ... .replace tzinfo None datetime.datetime 2008 12 16 13 0 I.e. in English get the current time in UTC convert it to some other..
Check if a given index already exists in a dictionary and increment it http://stackoverflow.com/questions/473099/check-if-a-given-index-already-exists-in-a-dictionary-and-increment-it that dictionary has already been set to a non None value I.e. I want to do this my_dict if my_dict some_value None my_dict.. None my_dict some_value 1 else my_dict some_value 1 I.e. I want to increment the value if there's already one there..
Dynamically adding a form to a Django formset with Ajax http://stackoverflow.com/questions/501719/dynamically-adding-a-form-to-a-django-formset-with-ajax add new forms to a Django formset with an ajax function. I.e. the user clicks an add button and some javascript will add..
Is there any way to do variable assignments directly inside a while(<here>) loop in Python? http://stackoverflow.com/questions/542212/is-there-any-way-to-do-variable-assignments-directly-inside-a-whilehere-loop here loop in Python Is there any way to do this in python I.e. have the variable assignment return the assigned value and..
http://stackoverflow.com/questions/5710441/call-cython-function-from-c a callback such as element wise operations on a vector. I.e. instead of just a you can do whatever arbitrary binary function...
Python mysqldb: Library not loaded: libmysqlclient.18.dylib http://stackoverflow.com/questions/6383310/python-mysqldb-library-not-loaded-libmysqlclient-18-dylib the problem by creating a symbolic link to the library. I.e. The actual library resides in usr local mysql lib And then..
Breaking out of nested loops [duplicate] http://stackoverflow.com/questions/653509/breaking-out-of-nested-loops 10 for y in range 10 print x y if x y 50 break both loops I.e. is there a nicer way than class BreakIt Exception pass try..
http://stackoverflow.com/questions/8725673/multiple-assignment-in-python x y call that spam then sets x to ham and y to spam . I.e. it's like ham y spam x y x ham y spam By contrast x y y x y..
|