¡@
python Programming Glossary: nowWhat can you use Python generator functions for? http://stackoverflow.com/questions/102535/what-can-you-use-python-generator-functions-for those that have a yield statement in them. I want to know what types of problems that these functions are really good.. calculations involving loops themselves where you don't know if you are going to need all results or where you don't want.. callback. The generator approach is that the work function now a generator knows nothing about the callback and merely yields..
Python math is wrong [duplicate] http://stackoverflow.com/questions/11950819/python-math-is-wrong science and you are coming of age. You therefore are now ready for the next step. I have been authorized by the BDFL.. The ancients understood it and deciphered it first and now so will you The Floating Point Guide Treat this document with.. this document with care Only share this with people you know have reached the same baffling conclusions share improve this..
What is the simplest way to SSH using Python? http://stackoverflow.com/questions/1233655/what-is-the-simplest-way-to-ssh-using-python
How to install MySQLdb (Python data access library to MySQL) on Mac OS X? http://stackoverflow.com/questions/1448429/how-to-install-mysqldb-python-data-access-library-to-mysql-on-mac-os-x site is intended to address these sorts of problems and I know that I'm going to need a reference to the solution in future.. that SO magic. Note Comments in next paragraph applied to Snow Leopard but not to Lion which appears to require 64 bit MySQL.. eggs Step 4 Originally required editing _mysql.c but is now NO LONGER NECESSARY. MySQLdb community seem to have fixed this..
Why does comparing strings in Python using either '==' or 'is' sometimes produce a different result? http://stackoverflow.com/questions/1504717/why-does-comparing-strings-in-python-using-either-or-is-sometimes-produce fails but if I change it to var1 var2 it returns True . now if I open my python interpreter and do the same is comparison..
Differences between isinstance() and type() in python http://stackoverflow.com/questions/1549801/differences-between-isinstance-and-type-in-python however offer extra goodies isinstance and issubclass can now mean more than just an instance of a derived class in particular..
What's the best SOAP client library for Python, and where is the documentation for it? [closed] http://stackoverflow.com/questions/206154/whats-the-best-soap-client-library-for-python-and-where-is-the-documentation-f link above this version was actually maintained until 2011 now it seems to be abandoned too. Of the above I've only used SUDS..
Fastest way to list all primes below N in python http://stackoverflow.com/questions/2068372/fastest-way-to-list-all-primes-below-n-in-python tmp 29 else 0 tmp const del_mult tmptk off start prime # now we go back to top tk1 so we need to increase pos by 1 pos 1.. need an if within the last while if lastadded 1 p.pop # now complete for every other possible prime while pos len tk1 cpos..
error: Unable to find vcvarsall.bat http://stackoverflow.com/questions/2817869/error-unable-to-find-vcvarsall-bat vcvarsall.bat I'm trying to install dulwich for bzr git. now I use Python 2.6 based bazaar. I use msys. My steps are as follows.. extension error Unable to find vcvarsall.bat If you know any hints tell me please. python windows mingw bazaar msys..
Python variable scope question http://stackoverflow.com/questions/370357/python-variable-scope-question as the first line of the function. As of python 3 there is now nonlocal c that you can use to refer to the nearest enclosing..
Non-blocking read on a subprocess.PIPE in python http://stackoverflow.com/questions/375427/non-blocking-read-on-a-subprocess-pipe-in-python work under Windows and Linux. here is how I do it for now It's blocking on the .readline if no data is avaible p subprocess.Popen.. blocking on both Windows and Linux is to use Queue.get_nowait import sys from subprocess import PIPE Popen from threading.. things here # read line without blocking try line q.get_nowait # or q.get timeout .1 except Empty print 'no output yet'..
How to improve performance of this code? http://stackoverflow.com/questions/4295799/how-to-improve-performance-of-this-code That test case is still running It's been about 5 minutes now . I'll update this if and when it finishes. What should I do..
Extending the User model with custom fields in Django http://stackoverflow.com/questions/44109/extending-the-user-model-with-custom-fields-in-django django.contrib.auth.models.User also works better now ever since the refactoring of Django's inheritance code in the..
Recommendations of Python REST (web services) framework? [closed] http://stackoverflow.com/questions/713847/recommendations-of-python-rest-web-services-framework CherryPy 's default dispatcher although both frameworks now provide a way around this problem class based views and MethodDispatcher..
Syntax error on print with Python 3 http://stackoverflow.com/questions/826948/syntax-error-on-print-with-python-3 print became a function. You need to include parenthesis now. print Hello World http docs.python.org 3.0 whatsnew 3.0.html#print..
Why is reading lines from stdin much slower in C++ than Python? http://stackoverflow.com/questions/9371238/why-is-reading-lines-from-stdin-much-slower-in-c-than-python LPS 3333333 Yes I ran it several times. So I guess I will now use scanf instead of getline. But I'm still curious if people.. a 100M line file on a fast disk. Here's the complete table now Implementation Lines per second cin default 819 672 python 3..
Adding a Method to an Existing Object http://stackoverflow.com/questions/972/adding-a-method-to-an-existing-object to do so. But how might one do this And if you don't know python can your language of choice do this If so how UPDATE.. argument of self but if you write actual code that way the now patched class method asks for an argument named self it doesn't..
What is a metaclass in Python? http://stackoverflow.com/questions/100003/what-is-a-metaclass-in-python Python uses to create all classes behind the scenes. Now you wonder why the heck is it written in lowercase and not Type.. Bar object pass b Bar b.__class__ class '__main__.Bar' Now what is the __class__ of any __class__ age.__class__.__class__.. at all it will use type to create the class object. Now the big question is what can you put in __metaclass__ The answer..
http://stackoverflow.com/questions/13058458/python-list-index 0 2 print b 2 So in your first line of code you have 4 0 . Now 0 is a pointer to the value 0 in memory and when you multiply.. this list you get four copies of the list pointer. Now when you change one of the values in one list all four change..
The Python yield keyword explained http://stackoverflow.com/questions/231767/the-python-yield-keyword-explained code will be run each time the for uses the generator. Now the hard part The first time the for calls the generator object..
Unexpected feature in a Python list of lists http://stackoverflow.com/questions/240178/unexpected-feature-in-a-python-list-of-lists 1 Then I changed one of the innermost values myList 0 0 5 Now my list looks like this 5 1 1 1 5 1 1 1 5 1 1 1 which is not..
How to install pip on windows? http://stackoverflow.com/questions/4750806/how-to-install-pip-on-windows Scripts to your path Start Edit environment variables . Now you should be able to run pip from the command line. Try installing..
Is it Pythonic to use list comprehensions for just side effects? http://stackoverflow.com/questions/5753597/is-it-pythonic-to-use-list-comprehensions-for-just-side-effects . def fun_with_side_effects x ...side effects... return y Now is it Pythonic to use list comprehensions to call this func..
What is the best way to implement nested dictionaries in Python? http://stackoverflow.com/questions/635483/what-is-the-best-way-to-implement-nested-dictionaries-in-python 62 'new york' 'queens county' 'plumbers' 9 'salesmen' 36 Now maintaining and creating this is pretty painful every time I..
http://stackoverflow.com/questions/886221/does-django-scale I choose to do so in the future. I heard Django was nice . Now that I'm getting closer to thinking about publishing my work..
list comprehension without [ ], Python http://stackoverflow.com/questions/9060653/list-comprehension-without-python Look at this ''.join str _ for _ in xrange 10 '0123456789' Now join 's argument is just str _ for _ in xrange 10 no but the..
Why is reading lines from stdin much slower in C++ than Python? http://stackoverflow.com/questions/9371238/why-is-reading-lines-from-stdin-much-slower-in-c-than-python line_count if ferror stdin perror Error reading stdin. Now here are the results using an even larger file 100M lines ~3.4GB..
Simple Digit Recognition OCR in OpenCV-Python http://stackoverflow.com/questions/9413216/simple-digit-recognition-ocr-in-opencv-python cv2.adaptiveThreshold blur 255 1 1 11 2 ################# Now finding Contours ################### contours hierarchy cv2.findContours.. samples np.savetxt 'generalresponses.data' responses Now we enter in to training and testing part. For testing part i..
Python: How do I pass a variable by reference? http://stackoverflow.com/questions/986006/python-how-do-i-pass-a-variable-by-reference it and have the changes reflected in the outer scope. Now let's see what happens when we try to change the reference that.. nothing we can do to change the contents of the string Now let's try to change the reference def try_to_change_string_reference..
Python read my outlook email mailbox and parse messages [duplicate] http://stackoverflow.com/questions/12291294/python-read-my-outlook-email-mailbox-and-parse-messages all the e mails and that we got compliments. Because NOW we are answering back the customers. not me the script Ok. now..
pytest running scenarios in the correct order in the class http://stackoverflow.com/questions/12521924/pytest-running-scenarios-in-the-correct-order-in-the-class def test_2 self pass def test_3 self pass it runs great NOW I'm adding the scenarios as it's recommended at pytest A quick..
How to eliminate last digit from each of the top lines http://stackoverflow.com/questions/1278664/how-to-eliminate-last-digit-from-each-of-the-top-lines Sequence 2.1.1 ATTCGCGCGAGTATAGCGGCG NOW I would like to remove the last digit from each of the line..
How can i grab CData out of BeautifulSoup http://stackoverflow.com/questions/2032172/how-can-i-grab-cdata-out-of-beautifulsoup q4 cows rule b br br ts get it now table width 100 tr td NOW td th NOW th tr table span 244 Cows span br br 67 leather br.. rule b br br ts get it now table width 100 tr td NOW td th NOW th tr table span 244 Cows span br br 67 leather br br 68 Brains..
How to insert arrays into a database? http://stackoverflow.com/questions/3738269/how-to-insert-arrays-into-a-database you INSERT INTO dog_measurements dog_id taken_at VALUES NOW where is the dog's ID from the dogs table. You'll then want..
Python: How to remove \n from a list element? http://stackoverflow.com/questions/3849509/python-how-to-remove-n-from-a-list-element list data from the first line into list1 and so on.... NOW THE QUESTION The problem I currently have is that it's showing..
Python wont remove items from list http://stackoverflow.com/questions/4301634/python-wont-remove-items-from-list but any help is appreciated thanks SORRY i FIXED IT NOW python list share improve this question The list comprehension..
Can't subtract offset-naive and offset-aware datetimes http://stackoverflow.com/questions/796008/cant-subtract-offset-naive-and-offset-aware-datetimes timezone unaware timestamps in PG and always insert using NOW AT TIME ZONE 'UTC' That way all my timestamps are UTC by default..
|